pCL- Eco Plasmid

PVT2203       2ug

 

pCL- Eco Plasmid Information

Promoter: CMV

Replicator: pUC ori, SV40 ori

Terminator: SV40 poly (A) signal

Plasmid classification: virus series, retrovirus packaging vector map

Plasmid size: 12341bp

Plasmid label: gag-pol

Prokaryotic resistance: Amp

Cloned strain: Stbl3

Culture conditions: 37 ℃, aerobic LB

Expression host: mammalian cells

Induction mode: no induction, instantaneous expression

5'sequencing primers: CMV-F:CGCAAATGGGCGGTAGGCGTG

3'sequencing primers: primers designed according to sequence

 

pCL- Eco Plasmid Description

pCL- Eco Plasmid packaging vector is a part of the RetroMax expression system and has been designed to maximize recombinant-retrovirus titers in a simple, efficient, and flexible experimental system. By introducing a retroviral vector into a cell expressing retroviral proteins, retroviral particles (virions) are shed into the culture medium at the rate of about 1 infectious particle/cell/day. Retrovirus tropism is determined at 3 levels. The first is simply a function of viral envelope protein, gp70. The envelope determines which cells the virus will enter. gp70 comes in three different flavors for gene therapy. Retroviruses obtained by cotransfection with pCL-Eco vector will infect mouse and rat cells, but not human cells.

 

pCL- Eco Plasmid Sequence