pLV3-U6-Vps35-sgRNA2-Cas9-Hyg Plasmid
Catalog No.:
PVT85507
pLV3-U6-Vps35-sgRNA2-Cas9-Hyg Plasmid
Alias:tacaacacagcaatcacccc
Host: Mammalian cells,lentivirus
Use(s): gene edit
Fragment Type: CRISPR
Fragmented species: Rat
Prokaryotic resistance: Amp
Screening Markers: Hyg
Fluorescence labeling:
Promoter: U6
Competent cells: Stbl3
Temperature: 37Celsius
Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.Take 2ul plasmid into 100 μ L corresponding competent cell, centrifugal then full coating on plate.
3. Shipping temperature is 2-8 degrees centigrade.