pLVX-mCherry-N1

Catalog No. PVT11067
Packing 2ug

pLVX-mCherry-N1 Information

Plasmid type: mammalian lentiviral expression vector

High copy / low copy: high copy

Promoter: CMV

Cloning methods: polyclonal sites, restrictive endonucleases

Carrier size: 8778 bp

5'sequencing primers and sequences: CMV-F: CGCAAATGGGCGGTAGGCGTG (Invitrogen)

3'sequencing primers and sequences: --

Carrier label: C-mCherry

Carrier resistance: ampicin

Screening markers: purinomycin (Puromycin)

Note: the carrier can express the C terminal mCherry fluorescent protein

Stability: /

Composition type: inducible type

Virus / non virus: lentivirus

pLVX-mCherry-N1 Description

pLVX-mCherry-N1 is a mammalian lentiviral expression vector, its resistance is ampicin and size is 8778 bp.