pLVX-mCherry-C1
PVTY00890 2ug
pLVX-mCherry-C1 Description
Plasmid type: Lentiviral vector Copy Number: High copy Promoter: CMV Cloning Method: Multiple cloning sites,restriction endonuclease Size: 8778 bp 5' Sequencing primers and sequences: CMV-F: CGCAAATGGGCGGTAGGCGTG(Invitrogen) Tags: N-mCherry Resistance(s): Ampicillin (Amp) Selectable markers: Puromycin? Note: The vector can express N-terminal mCherry fluorescent protein. |
Caution:
1. This product is FOR RESEARCH USE ONLY!