pPICZαB

PVT4008

 

pPICZαB Information

Promoter: TEF1, AOX1, EM7

Replicon: pUC ori

Terminator: AOX1 TT

Plasmid classification: yeast series, Pichia pastoris expression vector

Plasmid tagging: C-Myc, C-His

Prokaryotic resistance: Zeo

Selection marker: Zeo

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: yeast cells

Induction mode: methanol induction

5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC

3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT

 

pPICZαB Description

PPICZ alpha A, B and C are 3.6 KB Pichia pastoris protein secreting expression vectors. The expressed recombinant protein is a fusion protein containing an N-terminal polypeptide encoding the secretory signal of a-factor from Saccharomyces cerevisiae. The vector can express the target protein at a high level in Pichia pastoris induced by methanol, and can be used in any Pichia pastoris, including X33, GS115, SMD1168H, KM71H. PPICZ alpha A, B and C series carriers contain the following contents:

(1) Strict regulation of the promoter of AOX1 at the 5'-terminus induces the expression of any gene of interest (Ellis et al., 1985; Koutz et al., 1989; tschopp et al., 1987A).

(2) alpha factor secreting signal can secrete the target protein.

(3) Zeocin resistance genes can be used for screening in E. coli and Pichia pastoris (Baron et al., 1992; Drocourt et al., 1990).

(4) C- ends contain Myc and His tags, which can be used to detect and purify recombinant proteins.

(5) pPICZ A, B, C three reading frames make it possible to clone the gene into the vector without any frame-shifting mutation.

 

pPICZαB Multiple cloning site

pPICZαB Sequence