PX334

Search name

PX334,Plasmid PX334,PX334 vector

PX334 Informaiton

Carrier name: PX334 or PX334-U6-DR-BB-DR-Cbh-NLS-hSpCas9n (D10A) -NLS-H1-shorttracr-PGK-puro

Plasmid type: CRISPR-Cas9 vector; gene knockout carrier; mammalian carrier

High copy / low copy: high copy

Insertion site: restrictive endonuclease, polyclonal site

Promoter: U6

Carrier size: 10151bp

5'sequencing primers and sequences: LKO.1 5':GACTATCATATGCTTACCGT

3'sequencing primers and sequences: BGH Reverse:TAGAAGGCACAGTCGAGG

Carrier labels: HA, NLS, SV40NLS (N TER)

Vector resistance: ampicillin

Screening markers: Puromycin

Cloned strain: Stbl3

Host cell (line): conventional mammalian cells, etc.

Remark: humanized S. pyogenes Cas9 (D10A) nickase; This plasmid separately encodes a, encodes, the second part of the system.

Stability: stable expression

Composition / inducible type: composition

Virus / non virus: non virus

Use:CRISPR-CAS11-sgRNA plasmid